View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0836_low_117 (Length: 266)
Name: NF0836_low_117
Description: NF0836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0836_low_117 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 21 - 237
Target Start/End: Complemental strand, 8063001 - 8062785
Alignment:
| Q |
21 |
atgaaagaggggtagcaggacttgaagcttgagcttttccggcatcagcagaaggaggaagaacggcggcgccgccataagaagaagggttgttttgaat |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8063001 |
atgaaagaggggtagcaggacttgaagcttgagcttttccggcatcagaagaaggaggaagaacggcggcgccgccataagaagaagggttgttttgaat |
8062902 |
T |
|
| Q |
121 |
tgcagatctctgctttttacacccccatgagtatgttacactactcaacaaagagaaacgatgatataataaagcaagaatttcagcagtttcaacttcc |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8062901 |
tgcagatctctgctttttacacccccatgagtatgttacactactcaacaaagagaaacgatgatataataaagcaagaatttcagcagtttcaacttcc |
8062802 |
T |
|
| Q |
221 |
ctttctgaccaatccaa |
237 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
8062801 |
ctttctgaccaatccaa |
8062785 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 765 times since January 2019
Visitors: 6035