View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0836_low_132 (Length: 254)
Name: NF0836_low_132
Description: NF0836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0836_low_132 |
 |  |
|
[»] scaffold0246 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0246 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: scaffold0246
Description:
Target: scaffold0246; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 33 - 252
Target Start/End: Complemental strand, 13875 - 13656
Alignment:
Q |
33 |
agaaccaacatcagaggcggaagtatgaaaatgatcctattatttgcatccgtcacaccaaacttaaccattgatccttcagtgaacttacgtgctttgc |
132 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
T |
13875 |
agaaccaacatcagaggcggaagtatgaaaatgatcctattatttgcatccgtcacaccaaacttaaccattgatcctttagtgaacttacgtgctttgc |
13776 |
T |
 |
Q |
133 |
aaatttgtttccactgcccataaatgatgcacggaagatccttgccattactgaacttcatgttacattttcagctataccccaagtaatcaactatcgt |
232 |
Q |
|
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||| |
|
|
T |
13775 |
aaatttgtttccactgcccataaatgatgtacggaagatccttgccattactgaacttcatgttacatttccagctataccgcaagtaatcaactatcgg |
13676 |
T |
 |
Q |
233 |
ccgttcggtcgcttcagcag |
252 |
Q |
|
|
| |||||||||||||||||| |
|
|
T |
13675 |
cagttcggtcgcttcagcag |
13656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 927 times since January 2019
Visitors: 6039