View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0836_low_137 (Length: 251)
Name: NF0836_low_137
Description: NF0836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0836_low_137 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 13 - 222
Target Start/End: Original strand, 21061380 - 21061589
Alignment:
| Q |
13 |
tagtctgagaatggaaaggcatgttttctataattttctaaaggaaattgatggaaagtaaagaagaaaaatctccttaaattatagcctctctttacta |
112 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
21061380 |
tagtctgggaatggaaaggcatgttttctataattttctaaaggaaattgatggaaagtaaaggagaaaaatctccttaaattatagcctctctttacta |
21061479 |
T |
|
| Q |
113 |
tttttcattggctatatgaaccatactctgaatcaattttaataacactatgagnnnnnnntttgagaggaaaaaattcgaaagagagttttatcatctg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
21061480 |
tttttcattggctatatgaaccatactctgaatcaattttaataacactatgagaaaaaaatttgagaggaaaaaatccgaaagagagttttattatctg |
21061579 |
T |
|
| Q |
213 |
atcaccatcc |
222 |
Q |
| |
|
|||||||||| |
|
|
| T |
21061580 |
atcaccatcc |
21061589 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 857 times since January 2019
Visitors: 6036