View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0836_low_138 (Length: 251)

Name: NF0836_low_138
Description: NF0836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0836_low_138
NF0836_low_138
[»] chr6 (1 HSPs)
chr6 (2-166)||(26360774-26360939)


Alignment Details
Target: chr6 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 2 - 166
Target Start/End: Original strand, 26360774 - 26360939
Alignment:
2 acgataaatcatattaaattgaggttgttaaagtggataacaacaaattaaactatatattaaaatgtta-gtatatttagcaattgttacttatacgat 100  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||    
26360774 acgataaatcatattaaattgaggttgttaaggtggataacaacaaattaaactatttattaaaatgttaagtatatttagcaattgttacttatacgat 26360873  T
101 ccattgatagatcacatccagtttagtgggtagtttttctacacatgtgtaatctctaacttttaa 166  Q
    | ||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||    
26360874 ctattgatagatcacattcagtttagtgggtagtttttctacacatgtgtaatctctagcttttaa 26360939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University