View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0836_low_138 (Length: 251)
Name: NF0836_low_138
Description: NF0836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0836_low_138 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 2 - 166
Target Start/End: Original strand, 26360774 - 26360939
Alignment:
Q |
2 |
acgataaatcatattaaattgaggttgttaaagtggataacaacaaattaaactatatattaaaatgtta-gtatatttagcaattgttacttatacgat |
100 |
Q |
|
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||| |
|
|
T |
26360774 |
acgataaatcatattaaattgaggttgttaaggtggataacaacaaattaaactatttattaaaatgttaagtatatttagcaattgttacttatacgat |
26360873 |
T |
 |
Q |
101 |
ccattgatagatcacatccagtttagtgggtagtttttctacacatgtgtaatctctaacttttaa |
166 |
Q |
|
|
| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
T |
26360874 |
ctattgatagatcacattcagtttagtgggtagtttttctacacatgtgtaatctctagcttttaa |
26360939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University