View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0836_low_139 (Length: 251)
Name: NF0836_low_139
Description: NF0836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0836_low_139 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 2 - 244
Target Start/End: Original strand, 519809 - 520051
Alignment:
Q |
2 |
atggctgtatttttcaggacggtgtgtgcttcacctctttagactacaaaaatgctcaacctgacccccttggagagtttgcagagaatttactcgctga |
101 |
Q |
|
|
|||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||| |
|
|
T |
519809 |
atggctgtatttttcacgacggtgtgtggttcacctctttagactacaaaaatgctcaacctgacccccttcgagagtttgcggagaatttactcgctga |
519908 |
T |
 |
Q |
102 |
aattaacaccaataatatgaaagacattactcgcttttgtaatgtctttgttgatttaaatttccaggtacttttcctttctgttgnnnnnnngggtgga |
201 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||| |
|
|
T |
519909 |
aattaacaccaataatatgaaagacattactcgcttttgtaatgtctttgttgatttgaatttccaggtacttttcctttctgttgtttttttgggtgga |
520008 |
T |
 |
Q |
202 |
tttcgcatgcctaaactacccttgatttttctctttcatctca |
244 |
Q |
|
|
|||||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
520009 |
tttcgcatgcctaaactacccttgctttttctctttcatctca |
520051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 182; Significance: 2e-98; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 2 - 244
Target Start/End: Complemental strand, 366747 - 366505
Alignment:
Q |
2 |
atggctgtatttttcaggacggtgtgtgcttcacctctttagactacaaaaatgctcaacctgacccccttggagagtttgcagagaatttactcgctga |
101 |
Q |
|
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||| ||| |
|
|
T |
366747 |
atggctgtatttttcaggacggtgtgtggttcacctctttagactacaaaaatgctcaacctgacccccttcgagagtttgctgagaatttactcgttga |
366648 |
T |
 |
Q |
102 |
aattaacaccaataatatgaaagacattactcgcttttgtaatgtctttgttgatttaaatttccaggtacttttcctttctgttgnnnnnnngggtgga |
201 |
Q |
|
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||| |
|
|
T |
366647 |
aattaacaccaatactatgaaagacattactcgcttttgtaatgtctttgttgatttgaatttccaggtacttttcctttctgttgtttttttgggtgga |
366548 |
T |
 |
Q |
202 |
tttcgcatgcctaaactacccttgatttttctctttcatctca |
244 |
Q |
|
|
||| | |||||||||| ||||||| |||||||||||||||||| |
|
|
T |
366547 |
ttttgtatgcctaaaccacccttgctttttctctttcatctca |
366505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 11 - 179
Target Start/End: Original strand, 529530 - 529698
Alignment:
Q |
11 |
tttttcaggacggtgtgtgcttcacctctttagactacaaaaatgctcaacctgacccccttggagagtttgcagagaatttactcgctgaaattaacac |
110 |
Q |
|
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| | |||||||| ||||||||| |||||||||||||||| |
|
|
T |
529530 |
tttttcaggacggtgtgtggttcacctctttagactacaaaaatgctcaacctgacccccttcgggagtttgctgagaatttagtcgctgaaattaacac |
529629 |
T |
 |
Q |
111 |
caataatatgaaagacattactcgcttttgtaatgtctttgttgatttaaatttccaggtacttttcct |
179 |
Q |
|
|
|||||||||| |||||||||| |||||||||||||||| ||||||||| ||||||||||||||||||| |
|
|
T |
529630 |
caataatatggaagacattacccgcttttgtaatgtctatgttgatttggatttccaggtacttttcct |
529698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 77 times since January 2019
Visitors: 6044