View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0836_low_146 (Length: 247)
Name: NF0836_low_146
Description: NF0836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0836_low_146 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 21270267 - 21270046
Alignment:
| Q |
1 |
tgcaattaggtaattaacgaactacattgaagatgggtcccatttatgaagttagtcactgatgtgatatttatctgtcttgtgagctaacagaatccaa |
100 |
Q |
| |
|
|||| |||||||||||| ||||||||||||||||| |||||||| |||||||||||||| ||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
21270267 |
tgcagttaggtaattaaaaaactacattgaagatggctcccatttctgaagttagtcactaatgtgatatttatctgtcttgtgagctaacaaaatccaa |
21270168 |
T |
 |
| Q |
101 |
acatgagttatcaaacctccaccgcttcttatttgttctgaatgataatcaacattgcaattggctgcagcataacacaacatctccacccacacactac |
200 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21270167 |
acatgagttatcaaacctccacctcttcttatttgttctgaatgataatctacattgcaattggctgcagcataacacaacatctccacccacacactac |
21270068 |
T |
 |
| Q |
201 |
atataatttcccatctgttttc |
222 |
Q |
| |
|
|||| ||||||||||||||||| |
|
|
| T |
21270067 |
atatgatttcccatctgttttc |
21270046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University