View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0836_low_149 (Length: 240)
Name: NF0836_low_149
Description: NF0836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0836_low_149 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 236
Target Start/End: Complemental strand, 47561048 - 47560813
Alignment:
Q |
1 |
ccagaatccaaattatttggctgcttgagtgcatggcgaattccaaattctccatgagtcaagagcgttgaaacaccaaattctcttctttttatataaa |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47561048 |
ccagaatccaaattatttggctgcttgagtgcatggcgaattccaaattctccatgagtcaagagcgttgaaacaccaaattctcttctttttatataaa |
47560949 |
T |
 |
Q |
101 |
gatcctttccacgttttagaagctattagttttttgaaagaattgcttaatttcttcctcctttctttgcttgtttattttacttttacaacaaggggga |
200 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
47560948 |
gatcctttccacgttttagaagctattagttttttgaaagaattgcttaatttcttcctcccttctttgcttgtttattttacttttacaacaaggggga |
47560849 |
T |
 |
Q |
201 |
atagtaaaacagcatgcctggaacaatccaatgaga |
236 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| |
|
|
T |
47560848 |
atagtaaaacagcatgcctggaacaatccaatgaga |
47560813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University