View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0836_low_150 (Length: 233)
Name: NF0836_low_150
Description: NF0836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0836_low_150 |
 |  |
|
[»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 18 - 233
Target Start/End: Original strand, 9490406 - 9490621
Alignment:
Q |
18 |
tatcagtggtgaagttttcatttgttaaagtgtatagaggaattgaagaacaaatttctttgttcagacctgaatctatgatccttattgtggaattttt |
117 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
9490406 |
tatcagtggtgaagttttcatttgttaaagtgtatagaggaattgaagagcaattttctttgttcagacctgaatctatgatccttattgtggaattttt |
9490505 |
T |
 |
Q |
118 |
gtagttgatggattctacaaagtactttccattgtatagatttagtattgtttgattcttctcacaggaaagttcataatttggatcaccgcagttttcg |
217 |
Q |
|
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||| |
|
|
T |
9490506 |
gtagttgatggattctacaaagtattttccattgtatagatttagtattgtttgattgttctcacaggaaagttcataatttggatcaccacagttttcg |
9490605 |
T |
 |
Q |
218 |
gggtcggtttgtagac |
233 |
Q |
|
|
|| ||||||||||||| |
|
|
T |
9490606 |
ggatcggtttgtagac |
9490621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University