View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0836_low_158 (Length: 219)
Name: NF0836_low_158
Description: NF0836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0836_low_158 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 168; Significance: 3e-90; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 20 - 195
Target Start/End: Complemental strand, 26879327 - 26879152
Alignment:
| Q |
20 |
gggagcgtggagcaggttagaacatcaatttttcaggctgtgtctgattggtattgttagcgtggttagggaaagtattaaggtgtcgcagaactattgt |
119 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26879327 |
gggagcatggagcaggttagaacatcaatttttcgggctgtgtctgattggtattgttagcgtggttagggaaagtattaaggtgtcgcagaactattgt |
26879228 |
T |
|
| Q |
120 |
attatggatctttgcccctttgaaatactgtctctaaactagagagcaactttactcggctccacatttcttaaaa |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26879227 |
attatggatctttgcccctttgaaatactgtctctaaactagagagcaactttactcggctccacatttcttaaaa |
26879152 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 20 - 87
Target Start/End: Complemental strand, 40248809 - 40248742
Alignment:
| Q |
20 |
gggagcgtggagcaggttagaacatcaatttttcaggctgtgtctgattggtattgttagcgtggtta |
87 |
Q |
| |
|
|||||||||| |||||||||| |||| | ||| ||| |||||| |||||||||||||||| ||||||| |
|
|
| T |
40248809 |
gggagcgtggtgcaggttagagcatctaatttccagactgtgtttgattggtattgttagtgtggtta |
40248742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 107 - 147
Target Start/End: Complemental strand, 40247225 - 40247185
Alignment:
| Q |
107 |
gcagaactattgtattatggatctttgcccctttgaaatac |
147 |
Q |
| |
|
||||||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
40247225 |
gcagaactagtgtattatggctctttgcccctttgaaatac |
40247185 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 650 times since January 2019
Visitors: 6033