View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0836_low_159 (Length: 218)
Name: NF0836_low_159
Description: NF0836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0836_low_159 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 1 - 189
Target Start/End: Complemental strand, 25939210 - 25939022
Alignment:
Q |
1 |
ccaagcatagacactaaataacaagaatctctgcatcatatatgcaatgtatactcggtacacaaatataatctctataatgccaaaattgtgtactgta |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||| |
|
|
T |
25939210 |
ccaagcatagacactaaataacaagaatctctgcatcatatatgcaatgtatactcagtacacaaatataatctctatagtgccaaaattgtgtactgta |
25939111 |
T |
 |
Q |
101 |
agcaaattccagacatcagatataacttgtatgcaacatatacaaaaataacaaatatcggatgcagcaaatcgaagtaaatgtcaagg |
189 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
T |
25939110 |
agcaaattccagacatcagatataacttgtatgcaacatatacaaaaataacaaatatcggatgcagcaaatcgaagtgaatgtcaagg |
25939022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University