View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0836_low_161 (Length: 213)
Name: NF0836_low_161
Description: NF0836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0836_low_161 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 180; Significance: 2e-97; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 1 - 196
Target Start/End: Original strand, 43208670 - 43208865
Alignment:
Q |
1 |
ccttttattatcttcatggacagtgtcattgctcgaattcaacctttctgatgcccacgagttttgggatgggtgacttctaaattctaatcagtcaggt |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
43208670 |
ccttttattatcttcatggacagtgtcattgctcaaattcaacctttctgatgcccacgagttttgggatgggtgacttctaaattctaatcagttaggt |
43208769 |
T |
 |
Q |
101 |
atagcatttggcactcatcaatcttgctctttatttgccagccatttgaattctgctttgtgatatgtctgcgtgttttgttctgtctgtgctgct |
196 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |
|
|
T |
43208770 |
atagcatttggcactcatcaatcttgctctttatttgccagccatttgaattctgctttgtgatatgtctgcgtgttttgttctgtttgtgttgct |
43208865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 1 - 191
Target Start/End: Original strand, 43188319 - 43188509
Alignment:
Q |
1 |
ccttttattatcttcatggacagtgtcattgctcgaattcaacctttctgatgcccacgagttttgggatgggtgacttctaaattctaatcagtcaggt |
100 |
Q |
|
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||| |||| |
|
|
T |
43188319 |
ccttttattatcttcatggacagtttcattgctcgaattcaacctttctgatgcccgcatgttttgggatgggtgacttctaaattctaatcagctaggt |
43188418 |
T |
 |
Q |
101 |
atagcatttggcactcatcaatcttgctctttatttgccagccatttgaattctgctttgtgatatgtctgcgtgttttgttctgtctgtg |
191 |
Q |
|
|
||||||||| | |||||||||||||||||||||||||| ||||||||||||| |||||||||| |||| |||||||||||||| |||| |
|
|
T |
43188419 |
gtagcatttgcccctcatcaatcttgctctttatttgccggccatttgaattcaactttgtgatacttctgtgtgttttgttctgtttgtg |
43188509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University