View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0836_low_162 (Length: 210)

Name: NF0836_low_162
Description: NF0836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0836_low_162
NF0836_low_162
[»] chr1 (2 HSPs)
chr1 (1-50)||(43188319-43188368)
chr1 (1-50)||(43208670-43208719)


Alignment Details
Target: chr1 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 43188319 - 43188368
Alignment:
1 ccttttattatcttcatggacagtgtcattgctcgaattcaacctctctg 50  Q
    |||||||||||||||||||||||| |||||||||||||||||||| ||||    
43188319 ccttttattatcttcatggacagtttcattgctcgaattcaacctttctg 43188368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 43208670 - 43208719
Alignment:
1 ccttttattatcttcatggacagtgtcattgctcgaattcaacctctctg 50  Q
    |||||||||||||||||||||||||||||||||| |||||||||| ||||    
43208670 ccttttattatcttcatggacagtgtcattgctcaaattcaacctttctg 43208719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 649 times since January 2019
Visitors: 6033