View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0836_low_162 (Length: 210)
Name: NF0836_low_162
Description: NF0836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0836_low_162 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 43188319 - 43188368
Alignment:
Q |
1 |
ccttttattatcttcatggacagtgtcattgctcgaattcaacctctctg |
50 |
Q |
|
|
|||||||||||||||||||||||| |||||||||||||||||||| |||| |
|
|
T |
43188319 |
ccttttattatcttcatggacagtttcattgctcgaattcaacctttctg |
43188368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 43208670 - 43208719
Alignment:
Q |
1 |
ccttttattatcttcatggacagtgtcattgctcgaattcaacctctctg |
50 |
Q |
|
|
|||||||||||||||||||||||||||||||||| |||||||||| |||| |
|
|
T |
43208670 |
ccttttattatcttcatggacagtgtcattgctcaaattcaacctttctg |
43208719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University