View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0836_low_38 (Length: 444)

Name: NF0836_low_38
Description: NF0836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0836_low_38
NF0836_low_38
[»] chr2 (1 HSPs)
chr2 (102-154)||(7872494-7872546)


Alignment Details
Target: chr2 (Bit Score: 53; Significance: 3e-21; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 102 - 154
Target Start/End: Complemental strand, 7872546 - 7872494
Alignment:
102 aggacaataaataaaaaagtcacacattgatctcatcacacgtctgaatcgga 154  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||    
7872546 aggacaataaataaaaaagtcacacattgatctcatcacacgtctgaatcgga 7872494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 4 times since January 2019
Visitors: 6046