View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0836_low_45 (Length: 419)
Name: NF0836_low_45
Description: NF0836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0836_low_45 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 211; Significance: 1e-115; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 1 - 243
Target Start/End: Complemental strand, 32269250 - 32269017
Alignment:
| Q |
1 |
caaaaattagtaaaagaataagatagacgagttcgatttccaacgctaattatgtcccctttcctcatcactagtaaacaccaccttttatttttcttat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32269250 |
caaaaattagtaaaagaataagatagacgagttcgatttccaacgctaattatgtcccctttcctcatcactagtaaacaccaccttttatttttcttat |
32269151 |
T |
|
| Q |
101 |
caaaattggcatgttacacgtttgaaccatgcactttcacaacatgacatatgcaagtccttctaaatcacaaatcatcatgcatgaacaaataatacca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32269150 |
caaaattggcatgttacacgtttgaaccatgcactttcacaacatgacatatgcaagtccttctaaatcacaaatcatcatgcatgaacaaataat---- |
32269055 |
T |
|
| Q |
201 |
ataataccatctctcactctacctcaaattccccctaaaattt |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32269054 |
-----accatctctcactctacctcaaattccccctaaaattt |
32269017 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 357 - 409
Target Start/End: Complemental strand, 3985826 - 3985774
Alignment:
| Q |
357 |
aactgcatacatcaaaagtaacaacagaacatcaaaattcatcatggatgact |
409 |
Q |
| |
|
||||||||| ||||||||||| ||||||| ||||| |||||||||||||||| |
|
|
| T |
3985826 |
aactgcataaatcaaaagtaaagacagaacctcaaacttcatcatggatgact |
3985774 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 105 times since January 2019
Visitors: 6050