View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0836_low_53 (Length: 386)
Name: NF0836_low_53
Description: NF0836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0836_low_53 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 93 - 337
Target Start/End: Original strand, 1599929 - 1600173
Alignment:
| Q |
93 |
cactatcatcttccaccacacacttgtcttccaagatggtatcatctgcacaaagctcgctaccaccagaatctatattgctgctcttgaaacagtggtc |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1599929 |
cactatcatcttccaccacacacttgtcttccaagatggtatcatctgcacaaagctcgctaccaccagaatctatattgctgctcttgaaacagtggtc |
1600028 |
T |
|
| Q |
193 |
agacatgcctgtgttatctgaagctggcccttttgcttctctgtatgagtcaccatcacatgacgaaaatacaccctcgggtgtgtccgaccatgaaccc |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1600029 |
agacatgcctgtgttatctgaagctggcccttttgcttctctgtatgagtcaccatcacatgacgaaaatacaccctcgggtgtgtccgaccatgaaccc |
1600128 |
T |
|
| Q |
293 |
ttttctggtattctttcattttgggtcatattttgcaagtataat |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1600129 |
ttttctggtattctttcattttgggtcatattttgcaagtataat |
1600173 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 42; Significance: 0.000000000000009; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 95 - 184
Target Start/End: Complemental strand, 37535115 - 37535026
Alignment:
| Q |
95 |
ctatcatcttccaccacacacttgtcttccaagatggtatcatctgcacaaagctcgctaccaccagaatctatattgctgctcttgaaa |
184 |
Q |
| |
|
|||||||| ||||||| |||||||||| ||||||| ||||||| |||||||| | | |||| | ||||||||| ||||||||||||||| |
|
|
| T |
37535115 |
ctatcatcctccaccaaacacttgtctcccaagatagtatcatttgcacaaaacgcactactgcaagaatctattttgctgctcttgaaa |
37535026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 64 times since January 2019
Visitors: 6043