View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0836_low_56 (Length: 379)
Name: NF0836_low_56
Description: NF0836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0836_low_56 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 1 - 361
Target Start/End: Complemental strand, 1655610 - 1655246
Alignment:
Q |
1 |
atcaaaatagtttgaagaaacataa-atcaatttcttaccaaaagaattgaaacttttccaaaataaggtgttggaggaatattgaagaactttgatatc |
99 |
Q |
|
|
||||||||||||||||||||||||| ||||||||||||||||||||| |||| ||||| |||||||||||||||||||||||||||||| ||||||||| |
|
|
T |
1655610 |
atcaaaatagtttgaagaaacataacatcaatttcttaccaaaagaaaggaaatttttcgaaaataaggtgttggaggaatattgaagaaatttgatatc |
1655511 |
T |
 |
Q |
100 |
atttgatggagaaattgttctcaaatatcaattatccgaaagtagtgcaaatatagttttgttacataccaagtcaaactgcgcactttgtgtgatgaga |
199 |
Q |
|
|
|||||||||||||||||||| ||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1655510 |
atttgatggagaaattgttcacaaatatgaattgtccgaaagtagtgcaaatatagttttgttacataccaagtcaaactgcgcactttgtgtgatgaga |
1655411 |
T |
 |
Q |
200 |
ttggaaaatgatttattaggacataaaatattatta--acnnnnnnnnnnnnnnngtttgaatttatccct-nnnnnnntgttagaattttaaaagaatt |
296 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| | ||| |||||||||||| ||||||||||||||||||||| |
|
|
T |
1655410 |
ttggaaaatgatttattaggacataaaatattattatcaacaaaaaaggaaaaaagttagaatttatccctaaaaaaaatgttagaattttaaaagaatt |
1655311 |
T |
 |
Q |
297 |
aactttaaggtcaagtacaaccgatattactgacattgttaggttgaatatctttgatgatgtcc |
361 |
Q |
|
|
||||||||||||| |||||||||||| ||| |||||||||||||||||||||||||||| ||||| |
|
|
T |
1655310 |
aactttaaggtcaggtacaaccgataataccgacattgttaggttgaatatctttgatggtgtcc |
1655246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 107 times since January 2019
Visitors: 6050