View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0836_low_59 (Length: 374)

Name: NF0836_low_59
Description: NF0836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0836_low_59
NF0836_low_59
[»] chr7 (1 HSPs)
chr7 (149-287)||(35162088-35162226)


Alignment Details
Target: chr7 (Bit Score: 135; Significance: 3e-70; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 135; E-Value: 3e-70
Query Start/End: Original strand, 149 - 287
Target Start/End: Complemental strand, 35162226 - 35162088
Alignment:
149 cggtaccattcataatagctttaaaaagttccgaatcagccctctttctactcgacctcttccccgttgaaacctcatccacatcatgcgataacggtaa 248  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35162226 cggtaccattcataatagctttaaaaagttccgaatcagccctctttctactcgacctcttccccgttgaaacctcatccacatcatgcgataacggtaa 35162127  T
249 ctccagctcattatgtggccccgcaatttccgattcatc 287  Q
    ||||||||||||||||||||||| |||||||||||||||    
35162126 ctccagctcattatgtggccccgtaatttccgattcatc 35162088  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 726 times since January 2019
Visitors: 6034