View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0836_low_60 (Length: 370)
Name: NF0836_low_60
Description: NF0836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0836_low_60 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 159; Significance: 1e-84; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 52 - 224
Target Start/End: Complemental strand, 32315197 - 32315028
Alignment:
Q |
52 |
tgatttgacacccttggttggaaattttgctcaactaatgcgatagagttaaatttgtttggacacttgacgtgggtttaacaaactcactcacatgttc |
151 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32315197 |
tgatttgacacccttggttggaaattttgctcaactaatgcgatagagttaaatttgtttggacacttgacgtgggtttaacaaactcactcacatgttc |
32315098 |
T |
 |
Q |
152 |
aattcagagtttgtagtagttcgtgatgaaaaaggaatctaacgtactgattttgtggattttgttggccttc |
224 |
Q |
|
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32315097 |
aattcagagtttg---tagttcgtgatgaaaaaggaatctaacgtactgattttgtggattttgttggccttc |
32315028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University