View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0836_low_64 (Length: 361)
Name: NF0836_low_64
Description: NF0836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0836_low_64 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 150; Significance: 3e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 83 - 240
Target Start/End: Complemental strand, 43033536 - 43033379
Alignment:
Q |
83 |
cacagatcgactactttaaacctatcttagagcgtgttggctctactccatcttgttacgcagattgattttatttaggtcttgtcttttatgcagattg |
182 |
Q |
|
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43033536 |
cacagatcgactactttatacctatcttagagcgtgttggctctactccatcttgttacgcagattgattttatttaggtcttgtcttttatgcagattg |
43033437 |
T |
 |
Q |
183 |
gctttactttaaatcctatttacctcctctccaattgaacacccttgcaactgcatca |
240 |
Q |
|
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43033436 |
gctttacttgaaatcctatttacctcctctccaattgaacacccttgcaactgcatca |
43033379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University