View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0836_low_65 (Length: 360)
Name: NF0836_low_65
Description: NF0836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0836_low_65 |
 |  |
|
[»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 178; Significance: 6e-96; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 178; E-Value: 6e-96
Query Start/End: Original strand, 130 - 360
Target Start/End: Complemental strand, 1655906 - 1655676
Alignment:
Q |
130 |
atgtgtcagtaccatatctaatattagtgtttgtgt-ggtgtttcatataggtttatacgacgaagagatgggaatagaaaactttggatcttacaattt |
228 |
Q |
|
|
|||||||||| ||||||||||| ||||||||||||| |||| |||||| |||| |||||||||||||||| ||||| |||||||||||||||||||||| |
|
|
T |
1655906 |
atgtgtcagtgccatatctaatgttagtgtttgtgttggtgcttcata--ggttcatacgacgaagagatgagaataaaaaactttggatcttacaattt |
1655809 |
T |
 |
Q |
229 |
cttgcatttgaaacaatgtgttgggcttcttgttcagcagttagaagcatttgaatgccaccttgacctttaaagggatcca-tggtaataactatagat |
327 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
1655808 |
cttgcatttgaaacaatgtgttgggcttcttgttcagcagttagaagcatttgaatgcctccttgacctttaaagggatccattggtaataactatagat |
1655709 |
T |
 |
Q |
328 |
caacaaaatcaacattcatagaaatcagaaaat |
360 |
Q |
|
|
||||||||||||||||||||||||||||||||| |
|
|
T |
1655708 |
caacaaaatcaacattcatagaaatcagaaaat |
1655676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 96 - 134
Target Start/End: Complemental strand, 1656000 - 1655962
Alignment:
Q |
96 |
tcaacagcgattggagacgtattcggtgtcatacatgtg |
134 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1656000 |
tcaacagcgattggagacgtattcggtgtcatacatgtg |
1655962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 863 times since January 2019
Visitors: 6037