View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0836_low_69 (Length: 351)
Name: NF0836_low_69
Description: NF0836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0836_low_69 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 1 - 262
Target Start/End: Original strand, 39444863 - 39445123
Alignment:
| Q |
1 |
ttgatgcacaattcaggatcggatgttcaggtttttctctctctcattactttagatctggtattcttcctaaaaggaaaggctctttctatattcatag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39444863 |
ttgatgcacaattcaggatcggatgttcaggttttt-tctctctcattactttagatctggtcttcttcctaaaaggaaaggctctttctatattcatag |
39444961 |
T |
|
| Q |
101 |
agattttatcatgaatttccccagggccatgttgaattaacaaaccagggccatctaattcaatgtgtgatagtgaacgggataaacgtaattagaggtg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
39444962 |
agattttatcatgaatttccccagggccatgttgaattaacaaaccagggccatctaattcaatgtgtgatagtgaacgggataaacgtaattggaggtg |
39445061 |
T |
|
| Q |
201 |
taagttagggaacagaaaaatcataattgcacatgtatccttttaatcatgttttgatgatg |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
39445062 |
taagttagggaacagaaaaatcataattgcacatgtagccttttaatcatgttttgaagatg |
39445123 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 62 times since January 2019
Visitors: 6043