View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0836_low_75 (Length: 348)
Name: NF0836_low_75
Description: NF0836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0836_low_75 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 309; Significance: 1e-174; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 309; E-Value: 1e-174
Query Start/End: Original strand, 12 - 320
Target Start/End: Complemental strand, 52171227 - 52170919
Alignment:
| Q |
12 |
agagagcaaaagagcaaagaatttacaacagttgcaatgaaactcgccggaatcaaatcgatagacaacgctcacgacgactccgtttgggcagtcacat |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52171227 |
agagagcaaaagagcaaagaatttacaacagttgcaatgaaactcgccggaatcaaatcgatagacaacgctcacgacgactccgtttgggcagtcacat |
52171128 |
T |
 |
| Q |
112 |
gggcaccggcaaccgccacccgaccacctctccttctcaccggctccctcgacgaaacggtacgcctatggaaatccgatgaccttgttctcgaacgcac |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52171127 |
gggcaccggcaaccgccacccgaccacctctccttctcaccggctccctcgacgaaacggtacgcctatggaaatccgatgaccttgttctcgaacgcac |
52171028 |
T |
 |
| Q |
212 |
caacaccggccactgtctcggcgtcgcttccgtcgctgctcaccctctcggctcaattgccgcttcttcttctcttgatagctttgttcgtgtctttgat |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52171027 |
caacaccggccactgtctcggcgtcgcttccgtcgctgctcaccctctcggctcaattgccgcttcttcttctcttgatagctttgttcgtgtctttgat |
52170928 |
T |
 |
| Q |
312 |
gttgattct |
320 |
Q |
| |
|
||||||||| |
|
|
| T |
52170927 |
gttgattct |
52170919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University