View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0836_low_86 (Length: 315)
Name: NF0836_low_86
Description: NF0836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0836_low_86 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 62 - 304
Target Start/End: Original strand, 6698477 - 6698719
Alignment:
| Q |
62 |
aaatagccttgaaatgttggctcagttgaagtccttatgaagaataggtatgcaaaagcaaagtgcagggaagtaacaaagaaacatattggttccataa |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
6698477 |
aaatagccttgaaatgttggctcagttgaagtccttatgaagaataggtatgcaaaagcaaagtgcagggaagtaacaaagaaacatactggttccataa |
6698576 |
T |
 |
| Q |
162 |
catcccaacttagctcccaaaatgtgagtctcatgaacccaagtgtttggattgttaaaaatcccaatccacagtaaagctcagtctgaacttgagcttt |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6698577 |
catcccaacttagctcccaaaatgtgagtctcatgaacccaagtgtttggattgttaaaaatcccaatccacagtaaagctcagtctgaacttgagcttt |
6698676 |
T |
 |
| Q |
262 |
tgccttgccatcaatcattgctttttgcttctccatattctct |
304 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6698677 |
tgccttgccatcaatcattgctttttgcttctccatattctct |
6698719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University