View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0836_low_91 (Length: 311)
Name: NF0836_low_91
Description: NF0836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0836_low_91 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 30 - 160
Target Start/End: Complemental strand, 4384906 - 4384776
Alignment:
| Q |
30 |
caaccttaaaaaatgtcagagaaaaattcattgatcttttttaatttattaatcattgttttaaaaattgtaccaaaggttgaatcggtaaaaccttgtg |
129 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||| |
|
|
| T |
4384906 |
caaccttaaaaaatgtcaaagaaaaattcattgatcttttttaatttattaatcattgttttaaaaattgtaccaaaggttgaactggtaaaacctcgtg |
4384807 |
T |
|
| Q |
130 |
atcattatttaattggtgcaatcggttcaac |
160 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
4384806 |
atcattatttaattggtgcaatcggttcaac |
4384776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 209 - 311
Target Start/End: Complemental strand, 4384727 - 4384626
Alignment:
| Q |
209 |
gcggttcaatatggttcaaatttagttcaatctaattcaaccaaacctcaatataatcgagatcaaatcaaaccgaccaaatggctgattcatggttcaa |
308 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||||||||||| || ||||||||||||||||||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
4384727 |
gcggttcaatttggtttaaatttagttcaatctaattcaatcagacctcaatataatcgagatcaaatc-acccgaccaaatggctgattcatggttcaa |
4384629 |
T |
|
| Q |
309 |
ccc |
311 |
Q |
| |
|
||| |
|
|
| T |
4384628 |
ccc |
4384626 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 16 times since January 2019
Visitors: 6041