View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0836_low_93 (Length: 307)
Name: NF0836_low_93
Description: NF0836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0836_low_93 |
 | |
|
| [»] scaffold0864 (1 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 224; Significance: 1e-123; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 63 - 294
Target Start/End: Original strand, 5444299 - 5444530
Alignment:
| Q |
63 |
tgaagaaagttccaaacaaggagaaattggtgctaagttggaaaaaggctcttcgtgaggcagcaaacatcgcagggtttccaatagtgaagtccgggta |
162 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5444299 |
tgaagaaagttccaaaaaaggagaaattggtgctaagttggaaaaaggctcttcgtgaggcagcaaacatcgcagggtttccaatagtgaagtccgggta |
5444398 |
T |
|
| Q |
163 |
atttcattcaacaactacttcttttcagattttcaagtaggccaaaaaggcccagagtttgaatgacaccaagcaacttgcagcttggtctttctcttaa |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5444399 |
atttcattcaacaactacttcttttcagattttcaagtaggccaaaaaggcccagagtttcaatgacaccaagcaacttgcagcttggtctttctcttaa |
5444498 |
T |
|
| Q |
263 |
cttgtatggactaatttgctagtaagcgatat |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
5444499 |
cttgtatggactaatttgctagtaagcgatat |
5444530 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 75 - 175
Target Start/End: Complemental strand, 5331673 - 5331573
Alignment:
| Q |
75 |
caaacaaggagaaattggtgctaagttggaaaaaggctcttcgtgaggcagcaaacatcgcagggtttccaatagtgaagtccgggtaatttcattcaac |
174 |
Q |
| |
|
||||| ||||| ||||||||| |||||||| | ||||||||||| | ||||| ||||| ||||||| |||| | ||||| ||||| |||||||||| |
|
|
| T |
5331673 |
caaacgaggagcaattggtgcaaagttggagagaggctcttcgtcatgcagctaacataaaagggtttgaaatactcaagtcacggtaaattcattcaac |
5331574 |
T |
|
| Q |
175 |
a |
175 |
Q |
| |
|
| |
|
|
| T |
5331573 |
a |
5331573 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0864 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0864
Description:
Target: scaffold0864; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 85 - 173
Target Start/End: Original strand, 4676 - 4764
Alignment:
| Q |
85 |
gaaattggtgctaagttggaaaaaggctcttcgtgaggcagcaaacatcgcagggtttccaatagtgaagtccgggtaatttcattcaa |
173 |
Q |
| |
|
||||||||||| || ||||| | ||| ||||||| ||||||| | ||| ||||||||| |||| | ||||| ||||||||||||||| |
|
|
| T |
4676 |
gaaattggtgcaaaattggagagaggatcttcgtcaggcagctagcattgcagggtttgaaatactcaagtcacggtaatttcattcaa |
4764 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 104 times since January 2019
Visitors: 6050