View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0836_low_98 (Length: 301)
Name: NF0836_low_98
Description: NF0836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0836_low_98 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 139; Significance: 9e-73; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 139; E-Value: 9e-73
Query Start/End: Original strand, 4 - 150
Target Start/End: Complemental strand, 10743449 - 10743303
Alignment:
Q |
4 |
ttgcactgtcactttgttttggttcccatgtgctgttcttctctgtctgtttgtttgatcaattgacttgacttttaatagtaaaaatttaaattcgcat |
103 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
10743449 |
ttgcactgtcactttgttttggctcccatgtgctgttcttctctgtctgtttgtttgatcaattgacttgacttttaatagtaaaaatttaaattcgcat |
10743350 |
T |
 |
Q |
104 |
tcagcaatagctcttgccaccagtatttaaatgcatacttcctctct |
150 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
T |
10743349 |
tcagcaatagctcttgccaccagtatttaaatgcatgcttcctctct |
10743303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 86 - 140
Target Start/End: Complemental strand, 10757790 - 10757736
Alignment:
Q |
86 |
aaaaatttaaattcgcattcagcaatagctcttgccaccagtatttaaatgcata |
140 |
Q |
|
|
||||||||||||| ||||||||||||||||||||||| | ||||||||||||||| |
|
|
T |
10757790 |
aaaaatttaaatttgcattcagcaatagctcttgccatcggtatttaaatgcata |
10757736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University