View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0836_low_99 (Length: 283)
Name: NF0836_low_99
Description: NF0836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0836_low_99 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 137; Significance: 1e-71; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 16 - 213
Target Start/End: Complemental strand, 36792906 - 36792706
Alignment:
Q |
16 |
atcgcctttgggagagcctaatatgtttgggcggctataaaacttacaaccctactgcttgaagcagaatcatcatacacttacccctataatttttaat |
115 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
T |
36792906 |
atcgcctttgggagagcctaatatgtttgggcggctataaaacttacaaccctactgcttgaagcagaatcatcatacacttacacctataatttttaat |
36792807 |
T |
 |
Q |
116 |
taaacagtatagtctaaaaacta---cnnnnnnnnnnnnnnaataaagtagtctaaaaattatatagtagtttaatcagaaggaataatttatgtggaaa |
212 |
Q |
|
|
|||| |||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36792806 |
taaatagtatagtctaaaaactacttcttttttttgttttgaataaagtagtctaaaaattatatagtagtttaatcagaaggaataatttatgtggaaa |
36792707 |
T |
 |
Q |
213 |
c |
213 |
Q |
|
|
| |
|
|
T |
36792706 |
c |
36792706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 173 - 213
Target Start/End: Complemental strand, 36786303 - 36786263
Alignment:
Q |
173 |
tatatagtagtttaatcagaaggaataatttatgtggaaac |
213 |
Q |
|
|
|||||||||||||||||| |||| ||||||||||||||||| |
|
|
T |
36786303 |
tatatagtagtttaatcataaggtataatttatgtggaaac |
36786263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 218 times since January 2019
Visitors: 6046