View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0837_high_11 (Length: 266)
Name: NF0837_high_11
Description: NF0837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0837_high_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 171; Significance: 7e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 171; E-Value: 7e-92
Query Start/End: Original strand, 40 - 247
Target Start/End: Original strand, 45211888 - 45212099
Alignment:
Q |
40 |
atcatttcttgcaacttttgagtaggagtattgtagagtgatatacatattgagctcggctatagattc----ttttaattttatttgagatgatgaata |
135 |
Q |
|
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||| |
|
|
T |
45211888 |
atcatttcttgcaactcttgagtaggagtattgtagagtgatatacatattgagctcggctatagattcattcttttaattttatttgaggtgatgaata |
45211987 |
T |
 |
Q |
136 |
tatttgttaaggtgcttccgtggatgtaggcaagaggggccaattcacataaatctctgttttacatcaaagattcatgggtgtgaggctaacttcgatg |
235 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
T |
45211988 |
tatttgttaaggtgcttccgtggatgtaggcaagaggtgccaattcacatcaatctctgttttacatcaaagattcatgggtgtgtggctaacttcgatg |
45212087 |
T |
 |
Q |
236 |
gtctgtgctgct |
247 |
Q |
|
|
|| ||||||||| |
|
|
T |
45212088 |
gtgtgtgctgct |
45212099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 112 - 142
Target Start/End: Original strand, 15679873 - 15679903
Alignment:
Q |
112 |
taattttatttgagatgatgaatatatttgt |
142 |
Q |
|
|
||||||||||||||||||||||||||||||| |
|
|
T |
15679873 |
taattttatttgagatgatgaatatatttgt |
15679903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University