View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0837_high_12 (Length: 265)
Name: NF0837_high_12
Description: NF0837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0837_high_12 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 73 - 237
Target Start/End: Original strand, 10786583 - 10786747
Alignment:
| Q |
73 |
tttgagatcccaaaattttgggaaccaactatttagctcgccttacacttgctaagggtcgggcctgactactataccaccggttaaataaccacatatc |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10786583 |
tttgagatcccaaaattttgggaaccaactatttagctcgccttacacttgctaagggtcgggcctgactactataccaccggttaaataaccacatatc |
10786682 |
T |
 |
| Q |
173 |
atgagttttaaaattaaaacgtgtttaaataatataataacttttttaattatacaacacaggtt |
237 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
10786683 |
atgagctttaaaattaaaacgtgtttaaataatataataacttttttaattatacaacataggtt |
10786747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 109; Significance: 6e-55; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 73 - 237
Target Start/End: Complemental strand, 50506239 - 50506075
Alignment:
| Q |
73 |
tttgagatcccaaaattttgggaaccaactatttagctcgccttacacttgctaagggtcgggcctgactactataccaccggttaaataaccacatatc |
172 |
Q |
| |
|
|||||| |||||||||| || ||||||||||||||||||||||| ||||||||||||| |||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
50506239 |
tttgaggtcccaaaattgtgtgaaccaactatttagctcgccttgcacttgctaagggccgggccggactactataccaccggttaaataaccacatatc |
50506140 |
T |
 |
| Q |
173 |
atgagttttaaaattaaaacgtgtttaaataatataataacttttttaattatacaacacaggtt |
237 |
Q |
| |
|
||||| |||||||| |||||||| |||||||||||||||| | |||||||||| |||| ||||| |
|
|
| T |
50506139 |
atgagatttaaaatcaaaacgtgcttaaataatataataattgctttaattatataacataggtt |
50506075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University