View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0837_high_14 (Length: 258)
Name: NF0837_high_14
Description: NF0837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0837_high_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 1 - 146
Target Start/End: Complemental strand, 2527148 - 2527005
Alignment:
| Q |
1 |
tcaccttcttcactttgattctgcattcaagaaaactgccaaccaccactcgatctcccccacttccactttgtgtgcagttaccacctctcaaaattct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| | |
|
|
| T |
2527148 |
tcaccttcttcactttgattctgcattcaagaaaactgccaaccaccactcgatctcccccacttccactttgtgtgcagttaccac--ctcaaaattat |
2527051 |
T |
|
| Q |
101 |
tgacatcttcccactagcgctaagcttccaacgatgctcacaggtt |
146 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2527050 |
tgacatcttcccactagcgctaagcttccaacgatgctcaccggtt |
2527005 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2316 times since January 2019
Visitors: 6161