View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0837_high_17 (Length: 246)
Name: NF0837_high_17
Description: NF0837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0837_high_17 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 34376861 - 34376620
Alignment:
Q |
1 |
ttaaggtgaataaatggatagtccagggttcaaacataatgcgatgttcatatcaaccgagctacgctcacgtgacgttgagagctannnnnnnattagt |
100 |
Q |
|
|
||||||| ||||||||| || |||||||||||||||||||| ||||| ||||||||| |||||||||||||| || ||||||||||| |||||| |
|
|
T |
34376861 |
ttaaggtaaataaatgggtaatccagggttcaaacataatgtgatgtccatatcaactgagctacgctcacgggatgttgagagctatttttttattagt |
34376762 |
T |
 |
Q |
101 |
tgtgtaagagaagctatgctatttaccttttcatatttgtgttttttaatcaaagtcgttgcatatacacataaagatatgagaactcttttgaaattat |
200 |
Q |
|
|
|||||||||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||||||||||||||||||||| || ||||||||||||||| |
|
|
T |
34376761 |
tgtgtaagagaagctatgctatttacctgttcatatttatgttttttaatcaaagttgttgcatatacacataaagatatgggagctcttttgaaattat |
34376662 |
T |
 |
Q |
201 |
agatttcatattttcctggacaattcattatatccctttgct |
242 |
Q |
|
|
||||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
34376661 |
agatttcatattttcctggacaattcattatatccttttgct |
34376620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1452 times since January 2019
Visitors: 6143