View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0837_high_2 (Length: 566)
Name: NF0837_high_2
Description: NF0837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0837_high_2 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 260; Significance: 1e-144; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 260; E-Value: 1e-144
Query Start/End: Original strand, 272 - 555
Target Start/End: Complemental strand, 51725749 - 51725466
Alignment:
| Q |
272 |
tctacaattatatttgtttatgaccaaaatcgagtgactatgggaagacttgaattccgtatagcaaaccctagatgtttgccttgttacttccagttgt |
371 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
51725749 |
tctaaaattatatttgcttatgaccaaaatcgagtgacaatgggaagacttgaattccgtatagcaaaccctaaatgtttgccttgttacttccagttgt |
51725650 |
T |
|
| Q |
372 |
gtaggtgtgaaagggtacacaccgcactttggtcaatgctaattaacacttgatgacaacaaatccagcaaaggatcagaatgaatttattattgttgaa |
471 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
51725649 |
gtaggtgtgaaagggtacacaccgcactttggtcaatgctaattaacacttgatgacaacaaagccagcaaaggatcagaatgaatttattattgttgaa |
51725550 |
T |
|
| Q |
472 |
aaacagaatgggttttttagatactagtagtacgtaacagtaaatgacaacgttcagattttaagcatatcgatctttattcat |
555 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
51725549 |
aaacagaatgggttttttagatactagtagtacgtaacagtaaatgacaacattcagattttaagcatatcgatctttattcat |
51725466 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 93; E-Value: 5e-45
Query Start/End: Original strand, 150 - 277
Target Start/End: Complemental strand, 51725898 - 51725771
Alignment:
| Q |
150 |
gaaagaccccagtagtatatgattattcttgtannnnnnnnngtagggaaatcagatatgattattcatgtatgttcgcaagagaaatataaatcactta |
249 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
51725898 |
gaaagaccccaatagtatatgattattcttgtatttttttttgtagggaaatcagatatgattattcatgtatgttggcaagagaaatataaatcactta |
51725799 |
T |
|
| Q |
250 |
aacacacttataaaatgttaattctaca |
277 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
51725798 |
aacacacttataaaatgttaattctaca |
51725771 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1355 times since January 2019
Visitors: 6140