View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0837_high_20 (Length: 223)
Name: NF0837_high_20
Description: NF0837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0837_high_20 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 137; Significance: 1e-71; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 17 - 190
Target Start/End: Complemental strand, 21440582 - 21440410
Alignment:
| Q |
17 |
tgtgttctctggttttattttggccagggaatattcatgtatatgctctgtagcaccgacacgtatgatcaaagacgtgttcaatgtctgagatcgacac |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21440582 |
tgtgttctctggttttattttggccagggaatattcatgtatatgctctgtagcaccgacacgtatgatcaaagacgtgttcaatgtctgagatcgacac |
21440483 |
T |
 |
| Q |
117 |
atcgcacatgtgattatattcgattatgtcannnnnnnncaaattatcatgggtgtgtatgtgtcagtgtcaat |
190 |
Q |
| |
|
||| |||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
21440482 |
atcacacatgtgattatattcgatcatgtca-tttttttcaaattatcatgggtgtgtatgtgtcagtgtcaat |
21440410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 42 - 93
Target Start/End: Complemental strand, 21441813 - 21441762
Alignment:
| Q |
42 |
agggaatattcatgtatatgctctgtagcaccgacacgtatgatcaaagacg |
93 |
Q |
| |
|
||||||||||||||||||||||| | | ||||||||||| |||| ||||||| |
|
|
| T |
21441813 |
agggaatattcatgtatatgctcaggaacaccgacacgtttgattaaagacg |
21441762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University