View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0837_high_21 (Length: 210)

Name: NF0837_high_21
Description: NF0837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0837_high_21
NF0837_high_21
[»] chr5 (1 HSPs)
chr5 (1-147)||(14065417-14065563)


Alignment Details
Target: chr5 (Bit Score: 139; Significance: 6e-73; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 139; E-Value: 6e-73
Query Start/End: Original strand, 1 - 147
Target Start/End: Original strand, 14065417 - 14065563
Alignment:
1 aattgtccaatttagaccatctttttcaactaatgaagctgaactcgaacctatgatggtagaacctctaaataagagatactatgagaataatatccat 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
14065417 aattgtccaatttagaccatctttttcaactaatgaagctgaactcgaacctatgatggtagaacctctaaatatgagatactatgagaataatatccat 14065516  T
101 cttggatttttacatcagttcagccaaatgatattttagtgacatat 147  Q
    |||||||||||||||||||||||||||||||| ||||||||||||||    
14065517 cttggatttttacatcagttcagccaaatgattttttagtgacatat 14065563  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 3143 times since January 2019
Visitors: 6169