View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0837_high_22 (Length: 203)
Name: NF0837_high_22
Description: NF0837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0837_high_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 46; Significance: 2e-17; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 3638060 - 3638105
Alignment:
| Q |
1 |
cattgatgactgcaactttagaatgggaaggtatacctgcatatgt |
46 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3638060 |
cattgatgactgcaactttagaatgggaaggtatacctgcatatgt |
3638105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 3 - 46
Target Start/End: Original strand, 3646929 - 3646972
Alignment:
| Q |
3 |
ttgatgactgcaactttagaatgggaaggtatacctgcatatgt |
46 |
Q |
| |
|
|||||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
3646929 |
ttgatgacagctactttagaatgggaaggtatacctgcatatgt |
3646972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University