View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0837_low_12 (Length: 284)
Name: NF0837_low_12
Description: NF0837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0837_low_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 166; Significance: 7e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 166; E-Value: 7e-89
Query Start/End: Original strand, 56 - 233
Target Start/End: Complemental strand, 42929671 - 42929494
Alignment:
Q |
56 |
atcatcatagcatacacgttactttccaagtcttcaaccgaggaaatgaaattcaatactatgcctactcacattaaacatgtatgactttgtgagacaa |
155 |
Q |
|
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
T |
42929671 |
atcatcatagcatatacgttactttccaagtcttcaaccgaggaaatgaaattcaatactatgcctacccacattaaacatgtatgactttgtgagacaa |
42929572 |
T |
 |
Q |
156 |
cagataaaagaaaactcacacttttattttctttggccaccggtttccggtcatcggttgaactaattgtctaatttt |
233 |
Q |
|
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
42929571 |
cagataaaagaaaattcacacttttattttctttggccaccggtttccggtcatcggttgaactaattgtctaatttt |
42929494 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University