View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0837_low_17 (Length: 263)
Name: NF0837_low_17
Description: NF0837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0837_low_17 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 146; Significance: 5e-77; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 110 - 263
Target Start/End: Original strand, 24711986 - 24712139
Alignment:
| Q |
110 |
ccaggaacatagaagtaattctttttcagagggggtgcagaaactacaaaattgtgcagaaattgtttgggtcaaaacagcttgaatccgttataggaaa |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24711986 |
ccaggaacatagaagtaattctttttcagagggggtgcagcaactacaaaattgtgcagaaattgtttgggtcaaaacagcttgaatccgttataggaaa |
24712085 |
T |
 |
| Q |
210 |
tgtcacactcaaagtagttattttttacaaacatcagatgatgttctggagaaa |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
24712086 |
tgtcacactcaaagtagttattttttacaaacatcggatgatgttctggagaaa |
24712139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 29 - 81
Target Start/End: Original strand, 24711904 - 24711956
Alignment:
| Q |
29 |
ataaatgaggaacaatgaaaccttgcataacattaaaatcagtaaagatacat |
81 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
24711904 |
ataaatgaggaacaatgaaacctcgcataacattaaaatcagtaaagatacat |
24711956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University