View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0837_low_18 (Length: 258)

Name: NF0837_low_18
Description: NF0837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0837_low_18
NF0837_low_18
[»] chr1 (1 HSPs)
chr1 (1-146)||(2527005-2527148)


Alignment Details
Target: chr1 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 1 - 146
Target Start/End: Complemental strand, 2527148 - 2527005
Alignment:
1 tcaccttcttcactttgattctgcattcaagaaaactgccaaccaccactcgatctcccccacttccactttgtgtgcagttaccacctctcaaaattct 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||| |    
2527148 tcaccttcttcactttgattctgcattcaagaaaactgccaaccaccactcgatctcccccacttccactttgtgtgcagttaccac--ctcaaaattat 2527051  T
101 tgacatcttcccactagcgctaagcttccaacgatgctcacaggtt 146  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||    
2527050 tgacatcttcccactagcgctaagcttccaacgatgctcaccggtt 2527005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 2136 times since January 2019
Visitors: 6159