View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0837_low_21 (Length: 246)

Name: NF0837_low_21
Description: NF0837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0837_low_21
NF0837_low_21
[»] chr6 (1 HSPs)
chr6 (1-242)||(34376620-34376861)


Alignment Details
Target: chr6 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 34376861 - 34376620
Alignment:
1 ttaaggtgaataaatggatagtccagggttcaaacataatgcgatgttcatatcaaccgagctacgctcacgtgacgttgagagctannnnnnnattagt 100  Q
    ||||||| ||||||||| || |||||||||||||||||||| ||||| ||||||||| |||||||||||||| || |||||||||||       ||||||    
34376861 ttaaggtaaataaatgggtaatccagggttcaaacataatgtgatgtccatatcaactgagctacgctcacgggatgttgagagctatttttttattagt 34376762  T
101 tgtgtaagagaagctatgctatttaccttttcatatttgtgttttttaatcaaagtcgttgcatatacacataaagatatgagaactcttttgaaattat 200  Q
    |||||||||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||||||||||||||||||||| || |||||||||||||||    
34376761 tgtgtaagagaagctatgctatttacctgttcatatttatgttttttaatcaaagttgttgcatatacacataaagatatgggagctcttttgaaattat 34376662  T
201 agatttcatattttcctggacaattcattatatccctttgct 242  Q
    ||||||||||||||||||||||||||||||||||| ||||||    
34376661 agatttcatattttcctggacaattcattatatccttttgct 34376620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 2003 times since January 2019
Visitors: 6156