View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0837_low_22 (Length: 233)

Name: NF0837_low_22
Description: NF0837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0837_low_22
NF0837_low_22
[»] chr5 (1 HSPs)
chr5 (1-226)||(14065417-14065642)


Alignment Details
Target: chr5 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 14065417 - 14065642
Alignment:
1 aattgtccaatttagaccatctttttcaactaatgaagctgaactcgaacctatgatggtagaacctctaaataagagatactatgagaataatatccat 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
14065417 aattgtccaatttagaccatctttttcaactaatgaagctgaactcgaacctatgatggtagaacctctaaatatgagatactatgagaataatatccat 14065516  T
101 cttggatttttacatcagttcagccaaatgatattttagtgacatatatttagagatcaaacaagcatctcttcaagatgaccacaattaggctattaat 200  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14065517 cttggatttttacatcagttcagccaaatgattttttagtgacatatatttagagatcaaacaagcatctcttcaagatgaccacaattaggctattaat 14065616  T
201 agcctaaccaagattgtcgcaggagg 226  Q
    ||||||||||||||||||||||||||    
14065617 agcctaaccaagattgtcgcaggagg 14065642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1210 times since January 2019
Visitors: 6138