View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0838_low_12 (Length: 244)
Name: NF0838_low_12
Description: NF0838
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0838_low_12 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 79; Significance: 5e-37; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 155 - 244
Target Start/End: Original strand, 32811102 - 32811192
Alignment:
| Q |
155 |
tgtccataactgcatgtgacttgacattgcttcataagtattcatagctaagatcct-aaaaacaaagaatattagaaccttaagccttaa |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
32811102 |
tgtccataactgcatgtgacttgacattgcttcataagtattcatagctaagatcctaaaaaaaaaagaatattagaaccttaagccttaa |
32811192 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 16 - 79
Target Start/End: Original strand, 32811041 - 32811104
Alignment:
| Q |
16 |
atgacaggaaaataaatgtgtgtgtccaactatgtagcacggacacttgcaagtaaaggtgtgt |
79 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
32811041 |
atgacaggaaaatgaatgtgtgtgtccaactatgtagcacggacacttgcgagtaaaggtgtgt |
32811104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2207 times since January 2019
Visitors: 6159