View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0839_high_11 (Length: 368)
Name: NF0839_high_11
Description: NF0839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0839_high_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 259; Significance: 1e-144; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 30 - 356
Target Start/End: Complemental strand, 33078988 - 33078664
Alignment:
| Q |
30 |
atagctctatgctttgaaccttacccataatttaatagaatgctattgttttatactccatgnnnnnnnnnccttaaacaattttcaacttggatgctct |
129 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
33078988 |
atagctctatgctttgaaccttacctataatttaatagaatgctattgttttatactccatgtttttttt-ccttaaacaattttcatcttggatgctct |
33078890 |
T |
|
| Q |
130 |
cacttggtgaagaagcaaagccaaacaagtttattggcaaaattgggacttagttgcagctctaatgtcaaaatcactacctgtcatggtgcaaaaatgc |
229 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33078889 |
cacttggtgaagaagcaaaaccaaacaagtttattagcaaaattgggacttagttgcagctctaatgtcaaaatcactacctgtcatggtgcaaaaatgc |
33078790 |
T |
|
| Q |
230 |
acggggctgattcatctttgtattcagcgttgaacaggatactcttctttactgttttccttagatgttcagctgagctcatattttgatctgcagagtc |
329 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
33078789 |
acggggctgattcatctttgtattcagcgttgaacaggacactcttc-ttactgttttccttagatgttcagctgagctcatattttgatttgcagagtc |
33078691 |
T |
|
| Q |
330 |
ttggttgtgttgtggttattttattca |
356 |
Q |
| |
|
||||||||||||||| ||||||||||| |
|
|
| T |
33078690 |
ttggttgtgttgtggatattttattca |
33078664 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 101 - 205
Target Start/End: Complemental strand, 41508471 - 41508368
Alignment:
| Q |
101 |
ccttaaacaattttcaacttggatgctctcacttggtgaagaagcaaagccaaacaagtttattggcaaaattgggacttagttgcagctctaatgtcaa |
200 |
Q |
| |
|
|||| ||| ||||||| | ||||||||||||||||||||||||||||| || |||||| |||| ||||||| |||||||||||| ||||||||||| || |
|
|
| T |
41508471 |
cctttaacgattttcatcgtggatgctctcacttggtgaagaagcaaaacc-aacaaggctattagcaaaatggggacttagttgtagctctaatgttaa |
41508373 |
T |
|
| Q |
201 |
aatca |
205 |
Q |
| |
|
||||| |
|
|
| T |
41508372 |
aatca |
41508368 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 101 - 207
Target Start/End: Complemental strand, 41518591 - 41518486
Alignment:
| Q |
101 |
ccttaaacaattttcaacttggatgctctcacttggtgaagaagcaaagccaaacaagtttattggcaaaattgggacttagttgcagctctaatgtcaa |
200 |
Q |
| |
|
||||||| ||||||| | ||||| ||||||||||||||||||||||| || |||||| ||| | |||| || ||||||||| ||||||||||| || |
|
|
| T |
41518591 |
ccttaaatgattttcatcgtggattctctcacttggtgaagaagcaaaacc-aacaaggccatttgtaaaaagggaacttagttgtagctctaatgtgaa |
41518493 |
T |
|
| Q |
201 |
aatcact |
207 |
Q |
| |
|
||||||| |
|
|
| T |
41518492 |
aatcact |
41518486 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2955 times since January 2019
Visitors: 6168