View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0839_high_17 (Length: 317)
Name: NF0839_high_17
Description: NF0839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0839_high_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 20 - 178
Target Start/End: Complemental strand, 40694986 - 40694821
Alignment:
| Q |
20 |
atactctactattgtactttactatatagcttaactactttatatgtctcttgatgttttcttac-----aaagtgtaataggttggatcatctcttgtt |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
40694986 |
atactctactattgtactttactatatagcttaactactttatatgtctcttgatgttttcttacaaattaaagtgtaataggttggatcatctcttgta |
40694887 |
T |
 |
| Q |
115 |
tatttttgaagcaatactcttttctt--tctcaatgaaacatccaaattttcacattttagtaaaa |
178 |
Q |
| |
|
||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40694886 |
tatttttgaagcaatactcttttttttctctcaatgaaacatccaaattttcacattttagtaaaa |
40694821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University