View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0839_high_29 (Length: 277)
Name: NF0839_high_29
Description: NF0839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0839_high_29 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 57 - 134
Target Start/End: Original strand, 15509086 - 15509163
Alignment:
| Q |
57 |
cgtagttaaggctttgtacgatgttattgatgatatccacgacttaggctctttagatatgctatgagactaatcatt |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15509086 |
cgtagttaaggctttgtacgatgttattgatgatatccacgacttaggctctttagatatgctatgagactaatcatt |
15509163 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 15509031 - 15509067
Alignment:
| Q |
1 |
gtttttcttttatattaatccactgcaaatgcgtccc |
37 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
15509031 |
gtttttcttttatattaatccaccgcaaatgcgtccc |
15509067 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1800 times since January 2019
Visitors: 6150