View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0839_high_39 (Length: 252)
Name: NF0839_high_39
Description: NF0839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0839_high_39 |
 |  |
|
| [»] chr1 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 196; Significance: 1e-107; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 8 - 252
Target Start/End: Original strand, 16828496 - 16828740
Alignment:
| Q |
8 |
cgaataatatcatgagtattgtcaaccgtcattnnnnnnngttataattttaagtactcaccctacttattatatttatatattttagagattaaattaa |
107 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16828496 |
cgaaaaatgtcatgagtattgtcaaccgtcattaaaaaaagttataattttaagtactcaccctacttattatatttatatattttagagattaaattaa |
16828595 |
T |
 |
| Q |
108 |
agataatggtagccccgacacttttgatgaaagacatgtggtgtccgacactgacatcatgattacgctgaattatgtcatttcttcaaattattatcag |
207 |
Q |
| |
|
|||||||| |||||||||||||||||||| |||||| ||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
16828596 |
agataatgatagccccgacacttttgatggaagacacgtggtgtccgacactgacaccatgattacgctgaattatgtcatttcatcaaattattatcag |
16828695 |
T |
 |
| Q |
208 |
tgtcaacatgttagtgtcgtggttggtgtccaagataaaaaccat |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16828696 |
tgtcaacatgttagtgtcgtggttggtgtccaagataaaaaccat |
16828740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 167 - 220
Target Start/End: Complemental strand, 29415792 - 29415739
Alignment:
| Q |
167 |
tgattacgctgaattatgtcatttcttcaaattattatcagtgtcaacatgtta |
220 |
Q |
| |
|
|||||| ||||||||||||||||| | |||||||||||||| ||||||||||| |
|
|
| T |
29415792 |
tgattatgctgaattatgtcattttcttaaattattatcagtttcaacatgtta |
29415739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 166 - 218
Target Start/End: Original strand, 30847734 - 30847786
Alignment:
| Q |
166 |
atgattacgctgaattatgtcatttcttcaaattattatcagtgtcaacatgt |
218 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||||| |||||||| ||||| |
|
|
| T |
30847734 |
atgattacattgaattatgtcattttttcaaattattagcagtgtcagcatgt |
30847786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 7)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 166 - 224
Target Start/End: Complemental strand, 4344787 - 4344729
Alignment:
| Q |
166 |
atgattacgctgaattatgtcatttcttcaaattattatcagtgtcaacatgttagtgt |
224 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||||||||| |||||| | ||||||||| |
|
|
| T |
4344787 |
atgattacactgaattatgtcattttttcaaattattatcggtgtcagcgtgttagtgt |
4344729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 178 - 218
Target Start/End: Complemental strand, 16315906 - 16315866
Alignment:
| Q |
178 |
aattatgtcatttcttcaaattattatcagtgtcaacatgt |
218 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
16315906 |
aattatatcatttcctcaaattattatcagtgtcaacatgt |
16315866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 169 - 225
Target Start/End: Complemental strand, 43001842 - 43001786
Alignment:
| Q |
169 |
attacgctgaattatgtcatttcttcaaattattatcagtgtcaacatgttagtgtc |
225 |
Q |
| |
|
||||| ||||||||||| |||| |||||||||||| ||||||| |||||| |||||| |
|
|
| T |
43001842 |
attacactgaattatgtaattttttcaaattattagcagtgtcgacatgtcagtgtc |
43001786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 170 - 225
Target Start/End: Original strand, 13287417 - 13287472
Alignment:
| Q |
170 |
ttacgctgaattatgtcatttcttcaaattattatcagtgtcaacatgttagtgtc |
225 |
Q |
| |
|
|||| ||||||||||| |||| |||||||||||||| ||||| || |||||||||| |
|
|
| T |
13287417 |
ttacactgaattatgtgattttttcaaattattatctgtgtcgacgtgttagtgtc |
13287472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 176 - 218
Target Start/End: Original strand, 38749587 - 38749629
Alignment:
| Q |
176 |
tgaattatgtcatttcttcaaattattatcagtgtcaacatgt |
218 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||| |||||| |
|
|
| T |
38749587 |
tgaattatgtcattttttcaaattattatcggtgtcgacatgt |
38749629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 169 - 210
Target Start/End: Original strand, 24906318 - 24906359
Alignment:
| Q |
169 |
attacgctgaattatgtcatttcttcaaattattatcagtgt |
210 |
Q |
| |
|
||||| |||||||||||||||| |||||||||||||| |||| |
|
|
| T |
24906318 |
attacactgaattatgtcattttttcaaattattatctgtgt |
24906359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 176 - 225
Target Start/End: Original strand, 32428950 - 32428999
Alignment:
| Q |
176 |
tgaattatgtcatttcttcaaattattatcagtgtcaacatgttagtgtc |
225 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||| ||||| |||||| |
|
|
| T |
32428950 |
tgaattatgtcactttctcaaattattatcagtgtcaccatgtcagtgtc |
32428999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 35; Significance: 0.00000000009; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 176 - 238
Target Start/End: Complemental strand, 17168929 - 17168867
Alignment:
| Q |
176 |
tgaattatgtcatttcttcaaattattatcagtgtcaacatgttagtgtcgtggttggtgtcc |
238 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||| || |||| |||||||| | ||||||| |
|
|
| T |
17168929 |
tgaattatgtcattttttcaaattattatcaatgtcgacgtgtttgtgtcgtgttcggtgtcc |
17168867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 166 - 212
Target Start/End: Complemental strand, 34446610 - 34446564
Alignment:
| Q |
166 |
atgattacgctgaattatgtcatttcttcaaattattatcagtgtca |
212 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
34446610 |
atgattacactgaattatgtcattttctcaaattattatccgtgtca |
34446564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 166 - 210
Target Start/End: Original strand, 19602195 - 19602239
Alignment:
| Q |
166 |
atgattacgctgaattatgtcatttcttcaaattattatcagtgt |
210 |
Q |
| |
|
|||||||| ||||||||| |||||| |||||||||||||||||| |
|
|
| T |
19602195 |
atgattacactgaattatatcattttctcaaattattatcagtgt |
19602239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.00000000009; HSPs: 7)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 178 - 228
Target Start/End: Original strand, 19323474 - 19323524
Alignment:
| Q |
178 |
aattatgtcatttcttcaaattattatcagtgtcaacatgttagtgtcgtg |
228 |
Q |
| |
|
||||||||||||| |||||||| |||||||||| |||||||||||||||| |
|
|
| T |
19323474 |
aattatgtcattttctcaaattactatcagtgtcgacatgttagtgtcgtg |
19323524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 167 - 210
Target Start/End: Complemental strand, 11093614 - 11093571
Alignment:
| Q |
167 |
tgattacgctgaattatgtcatttcttcaaattattatcagtgt |
210 |
Q |
| |
|
||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
11093614 |
tgattactttgaattatgtcattttttcaaattattatcagtgt |
11093571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 166 - 208
Target Start/End: Complemental strand, 20691364 - 20691322
Alignment:
| Q |
166 |
atgattacgctgaattatgtcatttcttcaaattattatcagt |
208 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
20691364 |
atgattacactgaattatgtcattttctcaaattattatcagt |
20691322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 166 - 210
Target Start/End: Original strand, 12704671 - 12704715
Alignment:
| Q |
166 |
atgattacgctgaattatgtcatttcttcaaattattatcagtgt |
210 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||||||| |||| |
|
|
| T |
12704671 |
atgattacattgaattatgtcattttttcaaattattatccgtgt |
12704715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 146 - 205
Target Start/End: Complemental strand, 21149133 - 21149073
Alignment:
| Q |
146 |
tggtgtccgacactgacatcat-gattacgctgaattatgtcatttcttcaaattattatc |
205 |
Q |
| |
|
|||||||||||| |||||| | |||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
21149133 |
tggtgtccgacaacgacatctttgattacactgaattatgtcattttctcaaattattatc |
21149073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 193 - 225
Target Start/End: Complemental strand, 28590891 - 28590859
Alignment:
| Q |
193 |
tcaaattattatcagtgtcaacatgttagtgtc |
225 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
28590891 |
tcaaattattatcggtgtcaacatgttagtgtc |
28590859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 193 - 225
Target Start/End: Original strand, 33353253 - 33353285
Alignment:
| Q |
193 |
tcaaattattatcagtgtcaacatgttagtgtc |
225 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |
|
|
| T |
33353253 |
tcaaattattatcagtttcaacatgttagtgtc |
33353285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000001; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 167 - 211
Target Start/End: Original strand, 29198689 - 29198733
Alignment:
| Q |
167 |
tgattacgctgaattatgtcatttcttcaaattattatcagtgtc |
211 |
Q |
| |
|
|||||||||||||||||| ||||| ||| |||||||||||||||| |
|
|
| T |
29198689 |
tgattacgctgaattatgccattttttctaattattatcagtgtc |
29198733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 192 - 225
Target Start/End: Complemental strand, 13487901 - 13487868
Alignment:
| Q |
192 |
ttcaaattattatcagtgtcaacatgttagtgtc |
225 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
13487901 |
ttcaaattattatcggtgtcaacatgttagtgtc |
13487868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 166 - 218
Target Start/End: Original strand, 38134420 - 38134472
Alignment:
| Q |
166 |
atgattacgctgaattatgtcatttcttcaaattattatcagtgtcaacatgt |
218 |
Q |
| |
|
|||||||| ||||||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
38134420 |
atgattacattgaattatgtcattttctcaaattattatcggtgtcaacatgt |
38134472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 166 - 228
Target Start/End: Original strand, 44317300 - 44317362
Alignment:
| Q |
166 |
atgattacgctgaattatgtcatttcttcaaattattatcagtgtcaacatgttagtgtcgtg |
228 |
Q |
| |
|
|||||||| ||||||||||||||| || ||| | |||||||||||||| |||||| |||||| |
|
|
| T |
44317300 |
atgattacattgaattatgtcatttttttaaaattttatcagtgtcaacgtgttagggtcgtg |
44317362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 6)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 166 - 218
Target Start/End: Original strand, 5654605 - 5654657
Alignment:
| Q |
166 |
atgattacgctgaattatgtcatttcttcaaattattatcagtgtcaacatgt |
218 |
Q |
| |
|
|||||||| ||||||||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
5654605 |
atgattacattgaattatgtcattttctcaaattattatcagtgtcgacatgt |
5654657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 166 - 211
Target Start/End: Original strand, 20743292 - 20743337
Alignment:
| Q |
166 |
atgattacgctgaattatgtcatttcttcaaattattatcagtgtc |
211 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
20743292 |
atgattacactgaattatgtcattttctcaaattattatccgtgtc |
20743337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 166 - 211
Target Start/End: Original strand, 31243562 - 31243607
Alignment:
| Q |
166 |
atgattacgctgaattatgtcatttcttcaaattattatcagtgtc |
211 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||||||| |||||| |
|
|
| T |
31243562 |
atgattacactgaattatgtcattttctcaaattattataagtgtc |
31243607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 166 - 218
Target Start/End: Complemental strand, 10546193 - 10546141
Alignment:
| Q |
166 |
atgattacgctgaattatgtcatttcttcaaattattatcagtgtcaacatgt |
218 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||||||| |||| |||||| |
|
|
| T |
10546193 |
atgattacattgaattatgtcattttctcaaattattatcattgtcgacatgt |
10546141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 169 - 225
Target Start/End: Complemental strand, 21945545 - 21945489
Alignment:
| Q |
169 |
attacgctgaattatgtcatttcttcaaattattatcagtgtcaacatgttagtgtc |
225 |
Q |
| |
|
||||| |||||||||||||||| |||||||||||| | ||||| ||||| |||||| |
|
|
| T |
21945545 |
attacactgaattatgtcattttttcaaattattagctgtgtcggcatgtcagtgtc |
21945489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 228
Target Start/End: Original strand, 24846802 - 24846854
Alignment:
| Q |
176 |
tgaattatgtcatttcttcaaattattatcagtgtcaacatgttagtgtcgtg |
228 |
Q |
| |
|
||||||||||||||| |||||||||||||||| ||||| | || |||||||| |
|
|
| T |
24846802 |
tgaattatgtcatttgctcaaattattatcagtttcaacgtattcgtgtcgtg |
24846854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000001; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 147 - 211
Target Start/End: Original strand, 30298443 - 30298506
Alignment:
| Q |
147 |
ggtgtccgacactgacatcatgattacgctgaattatgtcatttcttcaaattattatcagtgtc |
211 |
Q |
| |
|
|||||||||||| |||| ||||||||| |||||||||||||||| | ||||||||||| ||||| |
|
|
| T |
30298443 |
ggtgtccgacaccgaca-catgattacactgaattatgtcattttattaaattattatcggtgtc |
30298506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 166 - 211
Target Start/End: Original strand, 10535773 - 10535818
Alignment:
| Q |
166 |
atgattacgctgaattatgtcatttcttcaaattattatcagtgtc |
211 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
10535773 |
atgattacactgaattatgtcattttctcaaattattatcggtgtc |
10535818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 176 - 217
Target Start/End: Complemental strand, 25317172 - 25317131
Alignment:
| Q |
176 |
tgaattatgtcatttcttcaaattattatcagtgtcaacatg |
217 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||| ||||| |
|
|
| T |
25317172 |
tgaattatgtcattttttcaaattattatcggtgtcgacatg |
25317131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University