View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0839_high_40 (Length: 251)
Name: NF0839_high_40
Description: NF0839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0839_high_40 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 27567148 - 27566912
Alignment:
| Q |
1 |
cttgggcattgattttgacggccctttgtttctttcactcatttgtgttccttcttttatattgtgtttgtgctattactggttctataattgtgtgcta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27567148 |
cttgggcattgattttgacggccctttgtttctttcactcatttgtgttcctt-ttttatattgtgtttgtgctattactggttctataattgtgtgcta |
27567050 |
T |
 |
| Q |
101 |
tcatctttgtggtgtgttgttgcatgtgttgataacaattagtagcgattgttgctcaaatgccctgtactttactcatttgaatctattacatatatgc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
27567049 |
tcatctttgtggtgtgttgttgcatgtgttgataacaattagtagcgattgttgctcaaatgccctgtactttactcatttgaatcaattacatatatgc |
27566950 |
T |
 |
| Q |
201 |
aatttcttattgtaacttttcttgcccactcttgatat |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27566949 |
aatttcttattgtaacttttcttgcccactcttgatat |
27566912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University