View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0839_high_44 (Length: 241)
Name: NF0839_high_44
Description: NF0839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0839_high_44 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 4 - 145
Target Start/End: Complemental strand, 27567257 - 27567116
Alignment:
Q |
4 |
gaaattagaccatgcatcaaattaaggaccatcacgtgtgtgaatgaagacccttagttcctttcactcatttcttctgctctgtgaactacatggtgaa |
103 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
27567257 |
gaaattagaccatgcatcaaattaaggaccatcacgtgtgtgaatgaagacccttagttcctttcactcatttcttctgctctgtgaactacatggtgaa |
27567158 |
T |
 |
Q |
104 |
caagtgttacttgggcattgattttgacggccctttgcttct |
145 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
27567157 |
caagtgttacttgggcattgattttgacggccctttgtttct |
27567116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3054 times since January 2019
Visitors: 6168