View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0839_high_45 (Length: 226)

Name: NF0839_high_45
Description: NF0839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0839_high_45
NF0839_high_45
[»] chr4 (2 HSPs)
chr4 (57-95)||(15509086-15509124)
chr4 (1-37)||(15509031-15509067)


Alignment Details
Target: chr4 (Bit Score: 35; Significance: 0.00000000008; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 57 - 95
Target Start/End: Original strand, 15509086 - 15509124
Alignment:
57 cgtagttaaggctttgtacgatgttattgatgatgtcca 95  Q
    |||||||||||||||||||||||||||||||||| ||||    
15509086 cgtagttaaggctttgtacgatgttattgatgatatcca 15509124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 15509031 - 15509067
Alignment:
1 gtttttcttttatattaatccactgcaaatgcgtccc 37  Q
    ||||||||||||||||||||||| |||||||||||||    
15509031 gtttttcttttatattaatccaccgcaaatgcgtccc 15509067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University