View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0839_low_17 (Length: 394)
Name: NF0839_low_17
Description: NF0839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0839_low_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 295; Significance: 1e-165; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 295; E-Value: 1e-165
Query Start/End: Original strand, 30 - 354
Target Start/End: Complemental strand, 8393279 - 8392953
Alignment:
| Q |
30 |
tttttgtagcctcttccattgcctcttcacctccaacagaacccannnnnnn--ctcactcaattcctcttcaatgatgagaatgaatattatcacatgt |
127 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8393279 |
tttttgtagcctcttccattgcctcttcacctccaacagaacccatttttttttctcactcaattcctcttcaatgatgagaatgaatattatcacatgt |
8393180 |
T |
|
| Q |
128 |
cattgaattcatagcataccaaagaaaaatcactttgccttttaagctaatttaatgatgctttttgaattgtttgatgaaggttgttttgagttgttgg |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8393179 |
cattgaattcatagcataccaaagaaaaatcactttgccttttaagctaatttaatgatgctttttgaattgtttgatgaaggttgttttgagttgttgg |
8393080 |
T |
|
| Q |
228 |
gatggtatgaaacacaaggaccactcaaggcttcaacccccaatcattatctgcagagacaaattaatcaaaggttaaataaactcttgattcagaagaa |
327 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8393079 |
gatggtatgaaacacaaggaccactcaaggcttcaacccccaatcattatctgcagagacaaattaatcaaaggttaaataaactcttgattcagaagaa |
8392980 |
T |
|
| Q |
328 |
tactagataaatattttgtagacatgt |
354 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
8392979 |
tactagataaatattttgtagacatgt |
8392953 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1098 times since January 2019
Visitors: 6137