View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0839_low_19 (Length: 363)
Name: NF0839_low_19
Description: NF0839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0839_low_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 15 - 231
Target Start/End: Original strand, 4503411 - 4503627
Alignment:
Q |
15 |
ggaccgggtctatattagataaccccttcaaactttatatgtattcgtgaattaaatagttataaagttactcacaaattgattgacctaaatttatctt |
114 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
T |
4503411 |
ggaccgggtctatattagataaccccttcaaactttatatgtattcgtgaattaaatagttataaagtaactcacatattgattgacctaaatttatctt |
4503510 |
T |
 |
Q |
115 |
aggttttgtgagctaagtgaattcacacctacaactaagattgagatcaagatattaatgaacttcaattaaagaacaatcttttgagagaacccaggtt |
214 |
Q |
|
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||| |
|
|
T |
4503511 |
aggttttatgagctaagtgaattcacacctacaactaagattgagatcaagatattaatgaaattcaattaaagaacaatcttttgagagaacccaagtt |
4503610 |
T |
 |
Q |
215 |
gtatcattactggaata |
231 |
Q |
|
|
||||||||||||||||| |
|
|
T |
4503611 |
gtatcattactggaata |
4503627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 235 - 334
Target Start/End: Original strand, 4503903 - 4504007
Alignment:
Q |
235 |
acgtattggtcaaactttaatcgtacctccaaacaaatttcaaattttcatgtg-----nnnnnnncttgagaagagaagggttaataaccacaaatatt |
329 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||| |
|
|
T |
4503903 |
acgtattggtcaaactttaatcgtacctccaaacaaatttcaaattttcatgtgttttttttttttcttgagaacagaagggttaataaccacaaatatt |
4504002 |
T |
 |
Q |
330 |
aaact |
334 |
Q |
|
|
||||| |
|
|
T |
4504003 |
aaact |
4504007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University